Review



algorithms cellengine analysis software cellcarta  (CellCarta)


Bioz Verified Symbol CellCarta is a verified supplier
Bioz Manufacturer Symbol CellCarta manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    CellCarta algorithms cellengine analysis software cellcarta
    Algorithms Cellengine Analysis Software Cellcarta, supplied by CellCarta, used in various techniques. Bioz Stars score: 99/100, based on 184 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellengine+analysis+software+cellcarta/CellEngine/pm34469729-272-104-108
    Average 99 stars, based on 184 article reviews
    algorithms cellengine analysis software cellcarta - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    DNA Sequencing:

    Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LoVo ATCC CCL-229 .. OVSAHO JCRB Cell Bank JCRB1046 OVKATE JCRB Cell Bank JCRB1044 SNU-119 Seoul National University - Korea N/A JHOS-2 RIKEN BRC Cell Bank RBRC-RCB1521 JHOM-2B RIKEN BRC Cell Bank RBRC-RCB1682 COV362 Public Health England 7071910 DLD-1 Horizon Discovery HD PAR-008 COV318 Sigma Aldrich 7071903 NKL Chen Lab, Institute of Biomedical Science (Taiwan) N/A Oligonucleotides CD9 multi-guide RNA probe1: GCGACAUACCGCAUAGUGGA Synthego N/A CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU Synthego N/A CD9 multi-guide RNA probe3: CUGCCCAUUGUAGGUGAUUA Synthego N/A Primer: CD9 Forward GAGCCAAGTTAGGAGCCAAGT Integrated DNA Technologies (IDT) Custom Primer: CD9 Reverse CGAGTACGTCCTTCTTGGGG Integrated DNA Technologies (IDT) Custom Primer: CD9 DNA sequencing CCTGAGAGAAGGCAGTGCTA Integrated DNA Technologies (IDT) Custom Software and algorithms CellEngine analysis software CellCarta https://cellengine.com/#/ Vortex Samusik et al., 2016 https://github.com/nolanlab/vortex/ Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/, Version 9 Inference of CRIPSR Edits (ICE) Synthego (Hsiau et al., 2019) https://ice.synthego.com/ MATLAB - Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/ wiki/Normalizing-FCS-Files MATLAB – Single Cell Debarcoder (Zunder et al., 2015) https://github.com/nolanlab/single-cell- debarcoder R environment R-project https://www.r-project.org Premessa R package (Zunder et al., 2015) https://github.com/ParkerICI/premessa Cytobank (Kotecha et al., 2010) https://cytobank.org/ Microsoft excel Microsoft https://www.microsoft.com/en-us/microsoft- 365/excel FlowJo BD Biosciences https://www.flowjo.com/ Other CyTOF2 mass cytometer Fluidigm N/A Sony SH800 cell sorter Sony Biotechnology N/A 7900HT Fast Real-Time PCR System Stanford Genomics N/A Keyence BZ-X800 microscope Keyence N/A BD LSRII flow cytometer BD Biosciences N/A 4D-Nucleofector unit Lonza N/A (Continued on next page) Cell Reports 36, 109632, August 31, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER ABI 3130xl sequencer Stanford Protein and Nucleic Acid Facility N/A Tecan Infinite M1000 microplate reader Stanford High-Throughput Bioscience Center N/A

    Software:

    Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LoVo ATCC CCL-229 .. OVSAHO JCRB Cell Bank JCRB1046 OVKATE JCRB Cell Bank JCRB1044 SNU-119 Seoul National University - Korea N/A JHOS-2 RIKEN BRC Cell Bank RBRC-RCB1521 JHOM-2B RIKEN BRC Cell Bank RBRC-RCB1682 COV362 Public Health England 7071910 DLD-1 Horizon Discovery HD PAR-008 COV318 Sigma Aldrich 7071903 NKL Chen Lab, Institute of Biomedical Science (Taiwan) N/A Oligonucleotides CD9 multi-guide RNA probe1: GCGACAUACCGCAUAGUGGA Synthego N/A CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU Synthego N/A CD9 multi-guide RNA probe3: CUGCCCAUUGUAGGUGAUUA Synthego N/A Primer: CD9 Forward GAGCCAAGTTAGGAGCCAAGT Integrated DNA Technologies (IDT) Custom Primer: CD9 Reverse CGAGTACGTCCTTCTTGGGG Integrated DNA Technologies (IDT) Custom Primer: CD9 DNA sequencing CCTGAGAGAAGGCAGTGCTA Integrated DNA Technologies (IDT) Custom Software and algorithms CellEngine analysis software CellCarta https://cellengine.com/#/ Vortex Samusik et al., 2016 https://github.com/nolanlab/vortex/ Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/, Version 9 Inference of CRIPSR Edits (ICE) Synthego (Hsiau et al., 2019) https://ice.synthego.com/ MATLAB - Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/ wiki/Normalizing-FCS-Files MATLAB – Single Cell Debarcoder (Zunder et al., 2015) https://github.com/nolanlab/single-cell- debarcoder R environment R-project https://www.r-project.org Premessa R package (Zunder et al., 2015) https://github.com/ParkerICI/premessa Cytobank (Kotecha et al., 2010) https://cytobank.org/ Microsoft excel Microsoft https://www.microsoft.com/en-us/microsoft- 365/excel FlowJo BD Biosciences https://www.flowjo.com/ Other CyTOF2 mass cytometer Fluidigm N/A Sony SH800 cell sorter Sony Biotechnology N/A 7900HT Fast Real-Time PCR System Stanford Genomics N/A Keyence BZ-X800 microscope Keyence N/A BD LSRII flow cytometer BD Biosciences N/A 4D-Nucleofector unit Lonza N/A (Continued on next page) Cell Reports 36, 109632, August 31, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER ABI 3130xl sequencer Stanford Protein and Nucleic Acid Facility N/A Tecan Infinite M1000 microplate reader Stanford High-Throughput Bioscience Center N/A

    Single Cell:

    Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LoVo ATCC CCL-229 .. OVSAHO JCRB Cell Bank JCRB1046 OVKATE JCRB Cell Bank JCRB1044 SNU-119 Seoul National University - Korea N/A JHOS-2 RIKEN BRC Cell Bank RBRC-RCB1521 JHOM-2B RIKEN BRC Cell Bank RBRC-RCB1682 COV362 Public Health England 7071910 DLD-1 Horizon Discovery HD PAR-008 COV318 Sigma Aldrich 7071903 NKL Chen Lab, Institute of Biomedical Science (Taiwan) N/A Oligonucleotides CD9 multi-guide RNA probe1: GCGACAUACCGCAUAGUGGA Synthego N/A CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU Synthego N/A CD9 multi-guide RNA probe3: CUGCCCAUUGUAGGUGAUUA Synthego N/A Primer: CD9 Forward GAGCCAAGTTAGGAGCCAAGT Integrated DNA Technologies (IDT) Custom Primer: CD9 Reverse CGAGTACGTCCTTCTTGGGG Integrated DNA Technologies (IDT) Custom Primer: CD9 DNA sequencing CCTGAGAGAAGGCAGTGCTA Integrated DNA Technologies (IDT) Custom Software and algorithms CellEngine analysis software CellCarta https://cellengine.com/#/ Vortex Samusik et al., 2016 https://github.com/nolanlab/vortex/ Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/, Version 9 Inference of CRIPSR Edits (ICE) Synthego (Hsiau et al., 2019) https://ice.synthego.com/ MATLAB - Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/ wiki/Normalizing-FCS-Files MATLAB – Single Cell Debarcoder (Zunder et al., 2015) https://github.com/nolanlab/single-cell- debarcoder R environment R-project https://www.r-project.org Premessa R package (Zunder et al., 2015) https://github.com/ParkerICI/premessa Cytobank (Kotecha et al., 2010) https://cytobank.org/ Microsoft excel Microsoft https://www.microsoft.com/en-us/microsoft- 365/excel FlowJo BD Biosciences https://www.flowjo.com/ Other CyTOF2 mass cytometer Fluidigm N/A Sony SH800 cell sorter Sony Biotechnology N/A 7900HT Fast Real-Time PCR System Stanford Genomics N/A Keyence BZ-X800 microscope Keyence N/A BD LSRII flow cytometer BD Biosciences N/A 4D-Nucleofector unit Lonza N/A (Continued on next page) Cell Reports 36, 109632, August 31, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER ABI 3130xl sequencer Stanford Protein and Nucleic Acid Facility N/A Tecan Infinite M1000 microplate reader Stanford High-Throughput Bioscience Center N/A

    Cytometry:

    Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LoVo ATCC CCL-229 .. OVSAHO JCRB Cell Bank JCRB1046 OVKATE JCRB Cell Bank JCRB1044 SNU-119 Seoul National University - Korea N/A JHOS-2 RIKEN BRC Cell Bank RBRC-RCB1521 JHOM-2B RIKEN BRC Cell Bank RBRC-RCB1682 COV362 Public Health England 7071910 DLD-1 Horizon Discovery HD PAR-008 COV318 Sigma Aldrich 7071903 NKL Chen Lab, Institute of Biomedical Science (Taiwan) N/A Oligonucleotides CD9 multi-guide RNA probe1: GCGACAUACCGCAUAGUGGA Synthego N/A CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU Synthego N/A CD9 multi-guide RNA probe3: CUGCCCAUUGUAGGUGAUUA Synthego N/A Primer: CD9 Forward GAGCCAAGTTAGGAGCCAAGT Integrated DNA Technologies (IDT) Custom Primer: CD9 Reverse CGAGTACGTCCTTCTTGGGG Integrated DNA Technologies (IDT) Custom Primer: CD9 DNA sequencing CCTGAGAGAAGGCAGTGCTA Integrated DNA Technologies (IDT) Custom Software and algorithms CellEngine analysis software CellCarta https://cellengine.com/#/ Vortex Samusik et al., 2016 https://github.com/nolanlab/vortex/ Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/, Version 9 Inference of CRIPSR Edits (ICE) Synthego (Hsiau et al., 2019) https://ice.synthego.com/ MATLAB - Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/ wiki/Normalizing-FCS-Files MATLAB – Single Cell Debarcoder (Zunder et al., 2015) https://github.com/nolanlab/single-cell- debarcoder R environment R-project https://www.r-project.org Premessa R package (Zunder et al., 2015) https://github.com/ParkerICI/premessa Cytobank (Kotecha et al., 2010) https://cytobank.org/ Microsoft excel Microsoft https://www.microsoft.com/en-us/microsoft- 365/excel FlowJo BD Biosciences https://www.flowjo.com/ Other CyTOF2 mass cytometer Fluidigm N/A Sony SH800 cell sorter Sony Biotechnology N/A 7900HT Fast Real-Time PCR System Stanford Genomics N/A Keyence BZ-X800 microscope Keyence N/A BD LSRII flow cytometer BD Biosciences N/A 4D-Nucleofector unit Lonza N/A (Continued on next page) Cell Reports 36, 109632, August 31, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER ABI 3130xl sequencer Stanford Protein and Nucleic Acid Facility N/A Tecan Infinite M1000 microplate reader Stanford High-Throughput Bioscience Center N/A

    Real-time Polymerase Chain Reaction:

    Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LoVo ATCC CCL-229 .. OVSAHO JCRB Cell Bank JCRB1046 OVKATE JCRB Cell Bank JCRB1044 SNU-119 Seoul National University - Korea N/A JHOS-2 RIKEN BRC Cell Bank RBRC-RCB1521 JHOM-2B RIKEN BRC Cell Bank RBRC-RCB1682 COV362 Public Health England 7071910 DLD-1 Horizon Discovery HD PAR-008 COV318 Sigma Aldrich 7071903 NKL Chen Lab, Institute of Biomedical Science (Taiwan) N/A Oligonucleotides CD9 multi-guide RNA probe1: GCGACAUACCGCAUAGUGGA Synthego N/A CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU Synthego N/A CD9 multi-guide RNA probe3: CUGCCCAUUGUAGGUGAUUA Synthego N/A Primer: CD9 Forward GAGCCAAGTTAGGAGCCAAGT Integrated DNA Technologies (IDT) Custom Primer: CD9 Reverse CGAGTACGTCCTTCTTGGGG Integrated DNA Technologies (IDT) Custom Primer: CD9 DNA sequencing CCTGAGAGAAGGCAGTGCTA Integrated DNA Technologies (IDT) Custom Software and algorithms CellEngine analysis software CellCarta https://cellengine.com/#/ Vortex Samusik et al., 2016 https://github.com/nolanlab/vortex/ Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/, Version 9 Inference of CRIPSR Edits (ICE) Synthego (Hsiau et al., 2019) https://ice.synthego.com/ MATLAB - Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/ wiki/Normalizing-FCS-Files MATLAB – Single Cell Debarcoder (Zunder et al., 2015) https://github.com/nolanlab/single-cell- debarcoder R environment R-project https://www.r-project.org Premessa R package (Zunder et al., 2015) https://github.com/ParkerICI/premessa Cytobank (Kotecha et al., 2010) https://cytobank.org/ Microsoft excel Microsoft https://www.microsoft.com/en-us/microsoft- 365/excel FlowJo BD Biosciences https://www.flowjo.com/ Other CyTOF2 mass cytometer Fluidigm N/A Sony SH800 cell sorter Sony Biotechnology N/A 7900HT Fast Real-Time PCR System Stanford Genomics N/A Keyence BZ-X800 microscope Keyence N/A BD LSRII flow cytometer BD Biosciences N/A 4D-Nucleofector unit Lonza N/A (Continued on next page) Cell Reports 36, 109632, August 31, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER ABI 3130xl sequencer Stanford Protein and Nucleic Acid Facility N/A Tecan Infinite M1000 microplate reader Stanford High-Throughput Bioscience Center N/A

    Microscopy:

    Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LoVo ATCC CCL-229 .. OVSAHO JCRB Cell Bank JCRB1046 OVKATE JCRB Cell Bank JCRB1044 SNU-119 Seoul National University - Korea N/A JHOS-2 RIKEN BRC Cell Bank RBRC-RCB1521 JHOM-2B RIKEN BRC Cell Bank RBRC-RCB1682 COV362 Public Health England 7071910 DLD-1 Horizon Discovery HD PAR-008 COV318 Sigma Aldrich 7071903 NKL Chen Lab, Institute of Biomedical Science (Taiwan) N/A Oligonucleotides CD9 multi-guide RNA probe1: GCGACAUACCGCAUAGUGGA Synthego N/A CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU Synthego N/A CD9 multi-guide RNA probe3: CUGCCCAUUGUAGGUGAUUA Synthego N/A Primer: CD9 Forward GAGCCAAGTTAGGAGCCAAGT Integrated DNA Technologies (IDT) Custom Primer: CD9 Reverse CGAGTACGTCCTTCTTGGGG Integrated DNA Technologies (IDT) Custom Primer: CD9 DNA sequencing CCTGAGAGAAGGCAGTGCTA Integrated DNA Technologies (IDT) Custom Software and algorithms CellEngine analysis software CellCarta https://cellengine.com/#/ Vortex Samusik et al., 2016 https://github.com/nolanlab/vortex/ Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/, Version 9 Inference of CRIPSR Edits (ICE) Synthego (Hsiau et al., 2019) https://ice.synthego.com/ MATLAB - Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/ wiki/Normalizing-FCS-Files MATLAB – Single Cell Debarcoder (Zunder et al., 2015) https://github.com/nolanlab/single-cell- debarcoder R environment R-project https://www.r-project.org Premessa R package (Zunder et al., 2015) https://github.com/ParkerICI/premessa Cytobank (Kotecha et al., 2010) https://cytobank.org/ Microsoft excel Microsoft https://www.microsoft.com/en-us/microsoft- 365/excel FlowJo BD Biosciences https://www.flowjo.com/ Other CyTOF2 mass cytometer Fluidigm N/A Sony SH800 cell sorter Sony Biotechnology N/A 7900HT Fast Real-Time PCR System Stanford Genomics N/A Keyence BZ-X800 microscope Keyence N/A BD LSRII flow cytometer BD Biosciences N/A 4D-Nucleofector unit Lonza N/A (Continued on next page) Cell Reports 36, 109632, August 31, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER ABI 3130xl sequencer Stanford Protein and Nucleic Acid Facility N/A Tecan Infinite M1000 microplate reader Stanford High-Throughput Bioscience Center N/A

    Flow Cytometry:

    Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LoVo ATCC CCL-229 .. OVSAHO JCRB Cell Bank JCRB1046 OVKATE JCRB Cell Bank JCRB1044 SNU-119 Seoul National University - Korea N/A JHOS-2 RIKEN BRC Cell Bank RBRC-RCB1521 JHOM-2B RIKEN BRC Cell Bank RBRC-RCB1682 COV362 Public Health England 7071910 DLD-1 Horizon Discovery HD PAR-008 COV318 Sigma Aldrich 7071903 NKL Chen Lab, Institute of Biomedical Science (Taiwan) N/A Oligonucleotides CD9 multi-guide RNA probe1: GCGACAUACCGCAUAGUGGA Synthego N/A CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU Synthego N/A CD9 multi-guide RNA probe3: CUGCCCAUUGUAGGUGAUUA Synthego N/A Primer: CD9 Forward GAGCCAAGTTAGGAGCCAAGT Integrated DNA Technologies (IDT) Custom Primer: CD9 Reverse CGAGTACGTCCTTCTTGGGG Integrated DNA Technologies (IDT) Custom Primer: CD9 DNA sequencing CCTGAGAGAAGGCAGTGCTA Integrated DNA Technologies (IDT) Custom Software and algorithms CellEngine analysis software CellCarta https://cellengine.com/#/ Vortex Samusik et al., 2016 https://github.com/nolanlab/vortex/ Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/, Version 9 Inference of CRIPSR Edits (ICE) Synthego (Hsiau et al., 2019) https://ice.synthego.com/ MATLAB - Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/ wiki/Normalizing-FCS-Files MATLAB – Single Cell Debarcoder (Zunder et al., 2015) https://github.com/nolanlab/single-cell- debarcoder R environment R-project https://www.r-project.org Premessa R package (Zunder et al., 2015) https://github.com/ParkerICI/premessa Cytobank (Kotecha et al., 2010) https://cytobank.org/ Microsoft excel Microsoft https://www.microsoft.com/en-us/microsoft- 365/excel FlowJo BD Biosciences https://www.flowjo.com/ Other CyTOF2 mass cytometer Fluidigm N/A Sony SH800 cell sorter Sony Biotechnology N/A 7900HT Fast Real-Time PCR System Stanford Genomics N/A Keyence BZ-X800 microscope Keyence N/A BD LSRII flow cytometer BD Biosciences N/A 4D-Nucleofector unit Lonza N/A (Continued on next page) Cell Reports 36, 109632, August 31, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER ABI 3130xl sequencer Stanford Protein and Nucleic Acid Facility N/A Tecan Infinite M1000 microplate reader Stanford High-Throughput Bioscience Center N/A



    Similar Products

    algorithms cellengine analysis software cellcarta  (CellCarta)
    99
    CellCarta algorithms cellengine analysis software cellcarta
    Algorithms Cellengine Analysis Software Cellcarta, supplied by CellCarta, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellengine+analysis+software+cellcarta/CellEngine/pm34469729-272-104-108
    Average 99 stars, based on 1 article reviews
    algorithms cellengine analysis software cellcarta - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier

    Image Search Results